[Alternative protein sources: bacteria Methylococcus capsulatus concentrate, characteristic of composition and biological value].

A promising growth vector of food protein production in the context of the Russian Federation's food sovereignty security is the use of microbial synthesis. Taking into consideration the proven promising use of biotechnological processes in the production of alternative protein sources, modern scientific research is focused, among other issues, on improving the technology of obtaining food microbial protein using a variety of substrates and strains-producers, as well as evaluating the consumer properties, food, biological value and safety of such products. The purpose of the research was to study and comparatively evaluate protein concentrate (PC) from bacteria Methylococcus capsulatus and basic food of animal and plant origin within the development of the technology of optimal in nutritional and biological value PC production. Material and methods. Analysis of the nutritional and biological value of PC obtained from denucleinized and purified from cell walls biomass of methanoxidizing bacteria Methylococcus capsulatus (strain GSB-15) was carried out on 46 indicators, including estimation of protein content and amino acid composition, fat content and fatty acid composition, ash and moisture. Biological studies based on measuring of net protein ratio / net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of PC protein. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Results. The nutritional value study of PC showed high protein content - 69.0%, the share of fat, moisture and ash, accounted for 0.17, 9.5 and 14.4%, respectively. The carbohydrate content was 7.0% (of which mono- and disaccharides were <0.1%). The results of a comparative assessment of Methylococcus capsulatus protein amino acid profile and basic food of animal and plant origin showed a balanced content of the most amino acids, the level of which is comparable with the protein of chicken egg, which is traditionally a standard of quality of complete protein. At the same time, the content of the essential amino acid tryptophan in PC was an order of magnitude lower than in chicken egg protein; the content of this amino acid in PC is comparable with incomplete plant proteins (sunflower, flax, rapeseed). The results of the biological value evaluation of the Methylococcus capsulatus protein in the experiment on rats indicate a relatively low biological value of the microbial synthesis protein, that is caused, most likely, by tryptophan deficiency. Rats of the test group had a significant decrease in body weight gain, feed/protein intake, coefficient of protein efficiency ratio, coefficient of net protein ratio, true protein biological value, true net protein utilization. Conclusion. The results of a comparative evaluation of PC from methanotrophic bacteria Methylococcus capsulatus denucleinized biomass and basic food of animal and plant origin indicate its relatively high nutritional value. However, the characteristics of this PC sample were not optimal in regard of protein biological value by reason of tryptophan deficiency. A single amino acid deficiency is not a valid argument for not using microbially synthesized protein in human nutrition, considering the capabilities of the modern food industry, including ways to enrich foodstuffs with missing components. In addition, there is every cause to believe that adjusting the hydrolysis technology used in the production of PC will allow to eliminate the essential amino acid loss, thereby increasing the biological value of this product.

[Monitoring methods for novel insect-derived food: the PCR protocol for the detection and identification of Hermetia Illucens insects based on the HEI-COI probe and primer system].

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

Systemic Biomarkers and Liver Morphology in Rats during Chronic Low-Dose Toxicant Administration against the Background of Vitamin Deficiency.

Liver morphology, intensity of apoptosis, and activity of xenobiotic metabolism enzymes were studied in a chronic model experiment in rats receiving a mixture of 6 pesticides against the background of life-long diets with adequate and insufficient supply of water-soluble vitamins. The dose of each pesticide in the mixture did not exceed the acceptable daily intake (1 ADI). It was found that chronic exposure to low doses of anthropogenic toxicants in combination with permanent vitamin deficiency provokes a number of liver changes, such as increased apoptosis activity, cytochrome P450 system depletion, steatosis, and inflammatory infiltration, which is a potential health risk factor.

[Rats' liver morphological features under conditions of different supply with vitamins and minerals].

The current practice of novel food safety assessment in the Russian Federation involves toxicological studies on the alimentary model of adaptation potential reduction of laboratory animals. Since vitamin and mineral deficiency can affect the size of structural elements of tissues, an objective estimation of the results obtained using this model is possible when determining the range of fluctuations of the studied morphometric parameters under conditions of different essential substances' supply, as well as under conditions of simulated toxic effects on the background of the corresponding supply. The purpose of the research was to investigate the morphological and morphometric features of the liver under the influence of reduced intake of vitamins and mineral elements in the combination with toxic effects of various nature, during growth and puberty of male Wistar rats. Material and methods. The article analyzed data of 4 model experiments on 140 animals that received semi-synthetic casein diet with different supply of vitamins B1, B2, B3, B6 and mineral elements Fe3+ and Mg2+, as well as data of 2 experiments on 180 animals with simulated toxic load of cadmium (Cd2+) salts and carbon tetrachloride. The animals were ~95 days old at the time of sampling, the duration of the experiments was ~65 days. For the analysis we used data on rats' body weight on the day of material sampling, absolute and relative liver weight, hepatocyte diameter, nucleus diameter and hepatocyte cytoplasm size in the central and peripheral zones of hepatic lobules. A total of 200 cells were analyzed in each group of animals. In accordance with the study design, all quantitative traits of the groups that received diets with an essential nutrient supply ranging from 75 to 2% were compared with the group that received a complete diet (100%). Results. Morphometric examination of hepatocytes revealed a linear decrease in the size of cell structural elements in the series of reducing the content of essential micronutrients in the diet. Under the conditions of 2-4% vitamin and mineral supply, cell and nucleus diameters as well as cytoplasm size were by ~16.8, 12.6 and 21.1% (p<0.05) lower respectively than in rats with optimal supply of these substances; under the conditions of 9-19% supply were by ~9.2, 9.7 and 8.7% lower (p<0.05); higher levels of supply caused reduction of hepatocyte, nucleus and cytoplasm sizes in a range not exceeding 5% (p>0.05). When comparing the size of hepatocytes of rats subjected to toxic load with the hepatocytes of rats referred to the reference standard, an increase in the size of hepatocytes under the action of carbon tetrachloride by 17.4% (p<0.05) on average and under the action of cadmium salts by 4.6% (p<0.05) was noted. Conclusion. Based on the analysis of liver morphological and morphometric studies' data, there were established sizes of hepatocytes structural elements in the rats kept on diets with decreasing supply with B group vitamins, iron and magnesium salts; the linear decrease in the sizes of structural elements of hepatocytes in the series of reduction of B group vitamins, iron and magnesium intake was revealed. Toxic exposures to carbon tetrachloride and cadmium salts against the background of a 19-30-75% supply with essential substances led to an increase in the hepatocytes size, the correlation between the degree of toxicant exposure and the supply level is not significant.

[The comprehensive studies of Hermetia illucens larvae protein's biological value].

A high protein content in the insect biomass allows to classify this product as a very promising source of protein, comparable in nutritional and biological value with proteins of animal origin. Despite a long history of safe use, in some countries insects are considered a new type of food which safety must be proven before entering the food market. The long-term Russian experience in novel food's research allows to identify the crucial stages, among which, along with toxicological and allergological tests, the protein's biological value determination takes an important place. The conclusion about the biological value of protein is formed on the basis of integrated use of chemical and biological methods, which gist comes down to the study of the nitrogen balance in the growing organism (biological method) and the calculation of the amino acid score (chemical method). The aim of the research was the comprehensive assessment of Black soldier fly (Hermetia illucens) larvae protein's biological value using chemical and biological methods. Material and methods. Biological studies based on measuring of net protein ratio/net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats, with an initial body weight of ~65.5±1.2 g. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of H. illucens protein. The diet's ingredients were replaced with the consideration of the proteins, fats, and carbohydrates content in the included product following the principle of isocaloricity and isonitrogenicity (by mass fraction of total nitrogen). H. illucens biomass and casein in the test and control groups, respectively, were the main significant sources of nitrogen in the diet. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Chemical studies included studies of the amino acid composition of H. illucens biomass protein and calculation of the digestible indispensable amino acid score (DIAAS). Results. The general condition of animals of the both groups during the whole experiment was satisfactory, the weekly body weight increase corresponded to the level of growth typical for Wistar rats, intergroup differences were not detected. Despite the fact that in a number of indicators the test group animals differed from the control [there were noted a decrease of the net protein ratio (by 5%, p>0.05), true protein digestibility (by 11%, p<0.05), net protein utilization (by 13%, p<0.05), caused by increased excretion of nitrogen with urine (by 8%, p>0.05) and feces (by 186%, p<0.05), with the same amount of nitrogen intake], the test rats' growth rate and the nitrogen's retention degree indicate a relatively high biological value of insect protein. According to the DIAAS, H. illucens protein is characterized by high content of histidine, threonine, valine, isoleucine and leucine (DIAAS=100 and more), and is also a source of sulfur-containing amino acids - methionine and cysteine (DIAAS=86) and lysine (DIAAS=97). Conclusion. The comprehensive studies of Hermetia illucens larvae protein's biological value demonstrated a high protein content, its balanced amino acid composition and high biological value, which allows to consider Hermetia illucens as a potential source of complete dietary protein.

[Effect of quercetin on morphological changes in nonalcoholic fatty liver disease in high fructose-fed rats].

The aim of this study was to examine the effect of polyphenol quercetin on morphological changes in nonalcoholic fatty liver disease (NAFLD) in rats fed high-fructose diet. For 20 weeks animals (n=8 in each group) of the 1st group were given standard diet and water; the 2nd group - standard diet and 20% fructose solution; the 3rd group - standard diet with quercetin supplementation (0.1%) and 20% fructose solution. Formalin-fixed and paraffin-embedded liver samples were sectioned, stained (hematoxilin and eosin, Van Gieson's stain), evaluated with the use of the SAF and NAS scales. Histological assessment did not reveal pathology in the structure of the liver of the 1st group rats (S0A0F0; NAS - 0, fibrosis - 0). The 2nd group rat livers disclosed micro-, mid- and macrovesicular steatosis, inflammation without ballooning, pericellular and periportal fibrosis (S2A1F2; NAS - 3, fibrosis - 2). Quercetintreated rats exhibited in liver significantly less steatosis without significant changes in inflammation and fibrosis features (S1A1F2; NAS - 2, fibrosis - 2) compared with rats of the 2nd group. The data obtained demonstrate the ability of quercetin to inhibit the development of NAFLD in rats fed a diet with a high content of fructose, by reducing the severity of hepatostatosis.

[Investigation of the liver DNA methylation profile of rats under the influence of hepatotoxicants of different nature].

The functional importance of DNA methylation, which is a special case of epigenetic variation, is meant for regulation of many biological processes, ranged from tissue specific gene expression to remodeling of chromatin structure. Disorders of the DNA methylation can cause changes in the cell's phenotype, providing a significant impact on the development of pathology. Both exogenous and endogenous factors are able to cause disruption of DNA methylation, while epigenetic changes usually precede the emergence of clinical and morphological symptoms of pathological process development, consequently the parameters of DNA methylation can be used as sensitive biomarkers to detect adverse effects on the organism. The purpose of the study was to identify genes of the liver, the methylation profile of which changes under the influence of hepatotoxicants of different nature. The experiment was carried out on 60 male Wistar rats with initial body weight (b.w.) 83.3±1.5 g. Animals were randomly divided into 6 groups - 1 control and 5 test groups, with 10 rats in each group. During the first two weeks of the experiment the rats of the 1-5th test groups were administered to aflatoxin B1 (200 Mg/kg b.w.), cadmium chloride 2,5-hydrate (2 mg/kg), monosodium glutamate (1000 mg/kg), epigallocatechin gallate (EGCG) (1000 mg/kg), paracetamol (150 mg/kg), accordingly. Methylation of the liver genes in rats was determined by using high-performance methods, based on bisulfite sequencing of reduced representation. For each sample from 12 to 30 million pairs of reads were received, genes which demonstrated significant changes in methylation when exposed to toxic factors were identified: aflatoxin B1 caused changes in the methylation of 57 genes; cadmium - 54 genes; monosodium glutamate - 39 genes; EGCG -198 genes; paracetamol - 167 genes. The comparison of genes with altered methylation in the experimental groups revealed that none of the genes repeatedly occurred under the influence of each toxicant out of five, the highest number of repeats accounted 3. As a result of the present analysis 7 genes have been selected: methylation change in Fan1 gene was observed when exposed to cadmium, monosodium glutamate, EGCG; gene Lppr2 - under the influence of aflatoxin B1, EGCG, paracetamol; gene Mlh3 - under the influence of aflatoxin B1, cadmium, paracetamol; Sirt7 gene - under the influence of cadmium, EGCG, paracetamol; gene Fbxo15 - when exposed to cadmium, monosodium glutamate, paracetamol; gene E2f1 - when exposed to cadmium, EGCG, paracetamol; gene Mrps16 - when exposed to cadmium, EGCG, paracetamol. On the basis of the received data the project of the panel of genes-biomarkers of toxic effect, including genes Fan1, Lppr2, Mlh3, Sirt7, Fbxo15, E2f1, Mrps16 has been formed.

[Problems of sex determination in birds exemplified by Gallus gallus domesticus].

The current views of sex determination in birds are considered mostly with the example of Gallus gallus domesticus, the species best studied in this respect. Data on the appearance of primordial germ cells, their migration to the primordial gonads, the role of hormonal factors in the regulation of sex differentiation, the sex chromosomes, putative genetic mechanisms of sex determination, and a possible contribution of dosage compensation are described. The review discusses the two best-grounded hypotheses on the roles of the Z and W chromosomes in sex determination.

[Karyotypic instability of peripheral blood lymphocytes in cows Bos taurus L. infected with bovine leukemia virus]. / Kariotipicheskaia nestabil'nost' limfotsitov perifericheskoi krovi korov Bos taurus L., infitsirovannykh virusom leikoza krupnogo rogatogo skota (KRS).

Chromosomal aberrations (CAs), sister-chromatid exchanges (SCEs), aneuploidy and proliferative potential (PP) were investigated in peripheral blood lymphocytes of healthy cows (control group-C), BLV-(bovine leucosis virus)-infected cattle without hematological abnormalities (RID--seropositive group (I) and affected with leucaemia (lymphocytosis (LC), lymphoma (L)). Nonrandom chromosomal (marker) aberrations were not found in the cow group at stage LC. The levels of aneuploidy and SCEs increased in the cow group at stage L compared to the cow group at stage I. Polyploidy: C--1.9 +/- 0.28, I--3.5 +/- 0.22, LC--6.1 +/- 0.82, L--10.5 +/- 0.51 (P < 0.01). Hypoploidy (2n = 58): C--3.0 +/- 0.17, I--54 +/- 0.71, LC--12.1 +/- 0.72, L--14.0 +/- 0.65 (P < 0.01). SCEs: C--3.8 +/- 0.26, I--5.4 +/- 0.15, LC--7.2 +/- 0.16, L--9.7 +/- 0.26 (P < 0.01). There are no differences in CAs rates and PP between groups of cows at all the observed stages of leucaemic process. The obtained results are discussed in terms of cytogenetic aspects of leucaemic process in cows.

[Heterochromatin and euchromatin regions in the chromosomes of various representatives of the subfamily Bovinae]. / Geterokhromatinovye i éukhromatinovye raiony khromosom nekotorykh predstavitelei podsemeistva Bovinae.

Heterochromatin distribution was studied in three species of subfamily Bovinae: bison (Bison bison), European bison (Bison bonasus), and gayal (Bos frontalis). In all of the studied species, C- and CMA3-banding and in situ hybridization with satellite DNAII (satDNAII) revealed the conservative distribution of heterochromatic regions in autosomes; sex chromosomes did not contain the classical constitutive heterochromatin. The Y chromosome was the most variable element of the karyotypes of both bison species and the gayal. A mechanism for formation of the acrocentric Y chromosome in B. bison was suggested. This hypothetical mechanism included breakage of the p arm at the telomeric region and subsequent translocation and inversion. The map of B. bison chromosomes (491 bands per haploid set) is presented. The data obtained are discussed in terms of speciation and the evolution of Bovinae karyotypes.

[Experimental-morphological study of morphogenetic potencies of homogeneous aggregates of different types of cells from the freshwater sponge Ephydatia fluviatilis (L.)]. / Eksperimental'no-morfologicheskoe issledovanie formoobrazatel'nykh potentsii odnorodnykh konglomeratov razlichnykh tipov kletok presnovodnoi gubki Ephydatia fluviatilis (L.).

The morphogenetic potencies of somatic cells of the fresh-water sponge Ephydatia fluviatilis in the developing aggregates depend on their initial specialization and the number of cells in the aggregate. The aggregates of nucleolar amoebocytes consisting of 500 or more cells have the highest morphogenetic potencies. All main cell types can arise in the developing homogeneous aggregates of nucleolar amoebocytes. The fine structure of nucleolar amoebocytes at different stages of development of the homogeneous aggregates was studied by means of electron microscopy. The structural rearrangements are described which accompany the process of redifferentiation of the nucleolar amoebocytes in other cell types.